|
OriGene
human recombinant nos2 ![]() Human Recombinant Nos2, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+(NM_000625)+Human+Recombinant+Protein/pm39615166-115-12-15 Average 94 stars, based on 1 article reviews
human recombinant nos2 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
OriGene
interference sequences shrna for nos2 ![]() Interference Sequences Shrna For Nos2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+Human+shRNA+Plasmid+Kit/pmc05909682-51-24-35 Average 90 stars, based on 1 article reviews
interference sequences shrna for nos2 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
luciferase reporter vector ![]() Luciferase Reporter Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+(NM_000625)+Human+3'+UTR+Clone/10__4172_slash_2155___9899__1000349-56-11-19 Average 92 stars, based on 1 article reviews
luciferase reporter vector - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
|
OriGene
inos ![]() Inos, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+Human+shRNA+Plasmid+Kit/pmc03246759-56-25-34 Average 90 stars, based on 1 article reviews
inos - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
human inos cdna plasmid ![]() Human Inos Cdna Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+(NM_000625)+Human+Tagged+ORF+Clone/pm19554613-41-5-12 Average 90 stars, based on 1 article reviews
human inos cdna plasmid - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Elabscience Biotechnology
inos nos2 ![]() Inos Nos2, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/Human+NOS2%2FiNOS+(Nitric+Oxide+Synthase+2/pm38389898-133-30-32 Average 93 stars, based on 1 article reviews
inos nos2 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
OriGene
pcmv6 xl4 human nos2 nm 000625 ![]() Pcmv6 Xl4 Human Nos2 Nm 000625, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+(NM_000625)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pmc04053102-46-10-13 Average 90 stars, based on 1 article reviews
pcmv6 xl4 human nos2 nm 000625 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
pcmv6 ac gfp nos2 ![]() Pcmv6 Ac Gfp Nos2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+(NM_000625)+Human+Tagged+ORF+Clone/pm35584114-290-2-5 Average 90 stars, based on 1 article reviews
pcmv6 ac gfp nos2 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
reverse 5 gcactttggagagcgggcaata ![]() Reverse 5 Gcactttggagagcgggcaata, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/NANOS2+(NM_001029861)+Human+Untagged+Clone/pmc06705466-209-12-15 Average 90 stars, based on 1 article reviews
reverse 5 gcactttggagagcgggcaata - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
nos2 lentiviral vector ![]() Nos2 Lentiviral Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/iNOS+(NOS2)+(NM_000625)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pmc10623363-155-6-10 Average 91 stars, based on 1 article reviews
nos2 lentiviral vector - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
rea314 ![]() Rea314, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/Nanog+Antibody%2C+anti-human%2C+REAfinity/pmc08519482-19-2-14 Average 94 stars, based on 1 article reviews
rea314 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Wuhan USCN
human nos 2 elisa kit ![]() Human Nos 2 Elisa Kit, supplied by Wuhan USCN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+nos2/human+nos+2+elisa+kit/pmc10878917-77-33-38 Average 90 stars, based on 1 article reviews
human nos 2 elisa kit - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Hydroxyurea inhibits proliferation and stimulates apoptosis through inducible nitric oxide synthase in erythroid cells.
doi: 10.1016/j.biopha.2024.117723
Figure Lengend Snippet: Fig. 1. Hydroxyurea induces NOS2 expression in erythroid cells. a) Immunocytochemistry for NOS2 protein in HEL92.1.7 cells treated with the indicated con centrations of hydroxyurea (HU) or vehicle (Ctrl) and quantification of NOS2-positive cells. b) Western blot analysis for NOS2 protein in HEL92.1.7 cells treated for 48 h with the indicated concentrations of HU or vehicle (Ctrl). Quantification of band intensity is shown, with β-actin used as a loading control and normalized to Ctrl. c) Western blot for phospho-NFκB p65 (Ser536) and total NFκB p65. d) Western blot for phospho-p38 and total p38. e) Western blot for phospho-ERK1/2 and total ERK1/2, with β-actin, on HEL92.1.7 cells treated with 100 μM HU for 5, 15, or 30 min, or vehicle (Ctrl). Quantification of band intensity is expressed as the phospho-to-total protein ratio and normalized to vehicle-treated cells. f) Western blot for NOS2 protein in HEL92.1.7 cells treated with the indicated concentrations of HU and/or 10 μM of JSH23 for 48 h. Quantification of band intensity is shown with β-actin used as a loading control and normalized to Ctrl. n = 3; mean + SEM, *p < 0.05, **p < 0.01, ***p < 0.001 vs. Ctrl or as indicated.
Article Snippet: In 40 μL of the reaction mix, 2 μL of 0.24 μg/μL
Techniques: Expressing, Immunocytochemistry, Western Blot, Control
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Hydroxyurea inhibits proliferation and stimulates apoptosis through inducible nitric oxide synthase in erythroid cells.
doi: 10.1016/j.biopha.2024.117723
Figure Lengend Snippet: Fig. 2. Hydroxyurea directly activates NOS2 in vitro. (a) Nitrite concentration in HEL92.1.7 cells treated with vehicle (Ctrl), HU, L-NAME, 1400W, or a combination of HU and L-NAME or 1400W. (b) Citrulline concentration in HEL92.1.7 cells treated with vehicle (Ctrl), HU, L-NAME, or a combination of HU and L-NAME. c) Western blot for phospho-NOS2 (Tyr151) and total NOS2 protein in HEL92.1.7 cells treated with the indicated concentrations of HU or vehicle (Ctrl). Quantification of band intensity is expressed as the phospho-NOS2 to total NOS2 ratio and normalized to vehicle-treated cells. d) Nitrite concentration in in vitro NOS enzymatic assays with the indicated concentrations of HU and incubation times. e) Citrulline concentration in in vitro NOS enzymatic assays with the indicated concentrations of HU and incubation times. f) In silico model of HU and NOS2 interaction showing binding at amino acids ASP382, ASP385, and ARG388, and with the substrate L- arginine (ARG700). g) Molecular dynamics analysis showing root mean square deviation (RMSD) of the C–Cα–N backbone versus simulation time for NOS2 in complex with and without HU during 20 ns. h) Root mean square fluctuation (RMSF) values of the NOS2-HU complex plotted against residue numbers. j) Radius of gyration (Rg) plots of NOS2 receptor with and without HU in active sites during 20 ns. a-e) n = 3; mean + SEM, *p < 0.05, **p < 0.01, ***p < 0.001 vs. Ctrl or 0.
Article Snippet: In 40 μL of the reaction mix, 2 μL of 0.24 μg/μL
Techniques: In Vitro, Concentration Assay, Western Blot, Incubation, In Silico, Binding Assay, Residue
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Hydroxyurea inhibits proliferation and stimulates apoptosis through inducible nitric oxide synthase in erythroid cells.
doi: 10.1016/j.biopha.2024.117723
Figure Lengend Snippet: Fig. 3. NOS2 inhibition or knockdown prevents HU-induced inhibition of HEL92.1.7 cell proliferation. HEL92.1.7 cells were treated with the indicated concen trations of NOS2-specific inhibitor 1400W alone or in combination with HU. a) Immunocytochemistry for Ki67 protein and quantification of Ki67-positive cells as a proliferation marker. b) Cell cycle analysis by flow cytometry. Debris and doublets were excluded, and the distribution in the phases of the cell cycle was determined based on the incorporation of PI. c) Percentage of cells in G0/G1, S, or G2/M phases of the cell cycle was quantified. d) Gating of NOS2kd HEL92.1.7 cells based on GFP expression. e) Quantification of NOS1-, NOS2-, or NOS3-positive cells in NOS2kd and control HEL92.1.7 cells after immunocytochemistry. f) Immunocyto chemistry for Ki67 protein in NOS2kd or control HEL92.1.7 cells treated or not with HU, and quantification of Ki67-positive cells. g) Example of gating for cell cycle distribution using PI by flow cytometry. Exclusion of debris, exclusion of doublets, distribution in G0/G1, S, or G2/M phases based on PI incorporation. h) Percentage of cells in G0/G1, S, or G2/M phases of the cell cycle in NOS2kd cells and controls treated or not with HU. n = 5; mean + SEM, *p < 0.05, **p < 0.01, ***p < 0.001 vs. Ctrl or as indicated.
Article Snippet: In 40 μL of the reaction mix, 2 μL of 0.24 μg/μL
Techniques: Inhibition, Knockdown, Immunocytochemistry, Marker, Cell Cycle Assay, Flow Cytometry, Expressing, Control
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Hydroxyurea inhibits proliferation and stimulates apoptosis through inducible nitric oxide synthase in erythroid cells.
doi: 10.1016/j.biopha.2024.117723
Figure Lengend Snippet: Fig. 4. NOS2 inhibition or knockdown prevents HU-induced apoptosis in HEL92.1.7 cells. HEL92.1.7 cells were treated with the indicated concentrations of NOS2- specific inhibitor 1400W alone or in combination with HU. a) Immunocytochemistry for ssDNA and quantification of ssDNA-positive cells. b) Example of gating for the apoptotic assay by flow cytometry. The bottom left quadrant represents early apoptotic cells, and the upper left quadrant represents late apoptotic cells. c) Percentage of early apoptotic cells. d) Percentage of late apoptotic cells. e) Immunocytochemistry for ssDNA on NOS2kd or control HEL92.1.7 cells treated or not with HU and quantification of ssDNA-positive cells. f) Example of gating for the apoptotic assay by flow cytometry with numbers of early and late apoptotic cells. g) Percentage of early and late apoptotic cells. n = 5; mean + SEM, *p < 0.05, **p < 0.01, ***p < 0.001 vs. Ctrl or as indicated.
Article Snippet: In 40 μL of the reaction mix, 2 μL of 0.24 μg/μL
Techniques: Inhibition, Knockdown, Immunocytochemistry, Flow Cytometry, Control
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Hydroxyurea inhibits proliferation and stimulates apoptosis through inducible nitric oxide synthase in erythroid cells.
doi: 10.1016/j.biopha.2024.117723
Figure Lengend Snippet: Fig. 5. In vivo HU treatment of Nos2–/– mice impairs HU inhibition of proliferation in erythroid progenitors. a) Schematic representation of experimental setup: Nos2–/– or wild-type (WT) mice were treated orally with 200 mg/kg HU or drinking water for 2 weeks. WT mice were injected with 20 mg/kg of 1400W twice daily for 3 consecutive days. Mouse erythroid progenitors (mERP) were isolated from bone marrow by immunomagnetic cell separation using anti-CD71-PE and anti- Ter119-FITC antibodies. b) Immunocytochemistry for Nos2 protein in mERP isolated from WT mice treated or not with HU. Quantification of Nos2-positive cells. c) Citrulline concentration in the bone marrow of WT and Nos2–/– mice treated or not with HU. d) Colony formation assay showing the number of late erythroid (CFU-E), early erythroid (BFU-E), or granulocyte/macrophage progenitors (CFU-GM) in the bone marrow of WT or Nos2–/– mice treated or not with HU. e) Immunocytochemistry for Ki67 in mERP cells isolated from WT and Nos2–/– mice treated or not with HU. f) Quantification of Ki67-positive cells. g) Cell cycle distribution by flow cytometry showing the percentage of cells in G0/G1, S, or G2/M phases of the cell cycle. c) n = 3, f) n = 5; mean + SEM, *p < 0.05, **p < 0.01, ***p < 0.001 vs. WT.
Article Snippet: In 40 μL of the reaction mix, 2 μL of 0.24 μg/μL
Techniques: In Vivo, Inhibition, Injection, Isolation, Immunocytochemistry, Concentration Assay, Colony Assay, Flow Cytometry
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Hydroxyurea inhibits proliferation and stimulates apoptosis through inducible nitric oxide synthase in erythroid cells.
doi: 10.1016/j.biopha.2024.117723
Figure Lengend Snippet: Fig. 6. In vivo HU treatment of Nos2–/– mice impairs HU stimulation of apoptosis in erythroid progenitors. a) Immunocytochemistry for Cas3 in mouse erythroid progenitors (mERP) after treatment of WT or Nos2–/– mice with 1400W and/or HU. b) Quantification of Cas3-positive mERP. c) Example of gating for Annexin V/PI apoptotic assay by flow cytometry with numbers of early and late apoptotic mERP cells. d) Percentage of early apoptotic mERP cells. e) Percentage of late apoptotic mERP cells. f) Percentage of total apoptotic mERP cells. n = 5; mean + SEM, *p < 0.05, **p < 0.01, ***p < 0.001 vs. WT.
Article Snippet: In 40 μL of the reaction mix, 2 μL of 0.24 μg/μL
Techniques: In Vivo, Immunocytochemistry, Flow Cytometry
Journal: PeerJ
Article Title: Inducible nitric oxide synthase (NOS2) knockout mice as a model of trichotillomania
doi: 10.7717/peerj.4635
Figure Lengend Snippet: (A) Phenotype of NOS2KO barbering behavior (BB), showing two vehicle- (A and B) and two clomipramine-treated (C and D) female NOS2KO. Effect of clomipramine (red squares; 10 mg/kg in the drinking water) on BB in males (E, n = 10/group) and females (F, n = 5/group) NOS2KO mice. (G) Effect of memantine (blue squares; 1 mg/kg in the drinking water) on BB in NOS2KO female mice ( n = 7/group). (H) The partial rescue of NOS2 expression delays the onset and intensity of barbering behavior ( n = 7–10/group). ∗ p < 0.05 from vehicle or NOS2.haploinsufficient group at the same time point. Photo credit: Plinio Cabrera Casarotto.
Article Snippet: Twenty-four hours later, the cells were transfected with a mixture of lipofectamine 2.5% in OptiMEM medium and 2 ug of plasmids of 4 different
Techniques: Expressing
Journal: PeerJ
Article Title: Inducible nitric oxide synthase (NOS2) knockout mice as a model of trichotillomania
doi: 10.7717/peerj.4635
Figure Lengend Snippet: Reduced total activity (A) and increased percentage of repetitive behaviors (B) in NOS2KO females compared to WT ( n = 6–7/group). Effect of clomipramine (10 mg/kg in the drinking water) on total activity (C) and repetitive behaviors (D) in NOS2KO females ( n = 5–6/group). (E) the silencing of NOS2 compromises the expression of MAP2 in KCl-induced differentiation of PC12 cells ( n = 4–5/group). ∗ p < 0.05 from WT, scrambled (scr) or vehicle-treated group.
Article Snippet: Twenty-four hours later, the cells were transfected with a mixture of lipofectamine 2.5% in OptiMEM medium and 2 ug of plasmids of 4 different
Techniques: Activity Assay, Expressing
Journal: Journal of Clinical & Cellular Immunology
Article Title: MicroRNA Regulation of Proinflammatory Response in X-linked Adrenoleukodystrophy
doi: 10.4172/2155-9899.1000349
Figure Lengend Snippet: Figure 2: iNOS levels are modulated by miRNA gain or loss of function. iNOS mRNA (A) and protein levels (B) decreased in miR-323-5p mimic-transfection group and increased in miR-323-5p-inhibitor transfection group. (C) The iNOS 3′UTR-luciferase construct was co- transfected in X-ALD patient-derived lymphocytes with miR-323-5p mimic or inhibitor or negative control (NGC) miRNA. Relative renilla luciferase activity is expressed as mean ± SD. Data are represented as the mean ± SD of three different experiments. Luciferase activity in mimic (MIM) and inhibitor (INB) were compared to NGC-transfected cells. ALD-C was compared to healthy controls (CTL). *p<0.05, **p<0.01, ***p<0.001. CTL: healthy control lymphocytes; ALD: X-ALD patient-derived lymphocytes.
Article Snippet: X-ALD patient-derived lymphocytes were transfected with human iNOS-3'UTR (SC206494) fused with
Techniques: Transfection, Luciferase, Construct, Derivative Assay, Negative Control, Activity Assay, Control
Journal: The Scientific World Journal
Article Title: New Role for L-Arginine in Regulation of Inducible Nitric-Oxide-Synthase-Derived Superoxide Anion Production in Raw 264.7 Macrophages
doi: 10.1100/2011/321979
Figure Lengend Snippet: iNOS protein expression, nitrite accumulation, and O 2 • − production in RAW 264.7 and iNOS −/− RAW 264.7 cells. Macrophages were stably transfected with shRNA against iNOS and then stimulated with LPS (50 ng/mL). RAW 264.7 and iNOS −/− RAW 264.7 cells were incubated in DMEM media containing 400 μ M of L-arginine. iNOS protein expression in cell lysates, accumulation of nitrite (a), and O 2 • − production in cell supernatants (b) were determined using methods described in ( n = 6). The O 2 • − production was also potentate using (c) PMA and (d) OZP with or without co-administration of LPS (50 ng/mL) ( n = 6). * P < 0.05.
Article Snippet: Using an electroporation system (Gene Pulser II, Bio-Rad laboratopries, USA, for details see [ ]), cells were transfected with plasmids containing the shRNA construct, against
Techniques: Expressing, Stable Transfection, Transfection, shRNA, Incubation
Journal: The Scientific World Journal
Article Title: New Role for L-Arginine in Regulation of Inducible Nitric-Oxide-Synthase-Derived Superoxide Anion Production in Raw 264.7 Macrophages
doi: 10.1100/2011/321979
Figure Lengend Snippet: Nitrotyrosine formation in (a) RAW 264.7 cells, (b) RAW 264.7 cells stimulated with LPS, (c) LPS-stimulated RAW 264.7 cells treated with L-NAME (25 μ M), (d) iNOS −/− RAW 264.7 cells, (e) iNOS −/− RAW 264.7 cells stimulated with LPS, and (f) RAW 264.7 cells transfected with negative control plasmid stimulated with LPS. Cells were incubated in the presence of DMEM media supplemented with 400 μ M of L-arginine.
Article Snippet: Using an electroporation system (Gene Pulser II, Bio-Rad laboratopries, USA, for details see [ ]), cells were transfected with plasmids containing the shRNA construct, against
Techniques: Transfection, Negative Control, Plasmid Preparation, Incubation
Journal: Breast Cancer Research : BCR
Article Title: Ets-1 is a transcriptional mediator of oncogenic nitric oxide signaling in estrogen receptor-negative breast cancer
doi: 10.1186/bcr3319
Figure Lengend Snippet: Ets-1 transcriptional activity in response to NOS2 expression and NO signaling . (a) Western blot of NOS2 and Ets-1 (thr 38) phosphorylation in MDA-MB-468 cells transfected with control plasmid and NOS2 expression plasmid in the presence of NOS2 substrate (L-Arg) or inhibitor (AG). (b) Western blot of phospho-Ets-1 (thr 38) compared to total Ets-1 in serum-starved cells exposed to either EGF (10 ng/ml) or DETANO. (c) Ets-luciferase activity in MDA-MB-468 cells transfected with either control or NOS2 expression plasmid and cultured in the presence of L-Arg or AG. Data represent mean fold luciferase activity compared to control plasmid incubated with L-Arg. (d) Ets-luciferase activity in serum-starved cells treated with either EGF or DETANO. Data represent mean fold luciferase activity compared to untreated control. Significant luciferase activity (** P < 0.01) was determined by one-way ANOVA from at least three independent experiments. AG, aminoguanidine; ANOVA, analysis of variance; DETANO, diethlylenetriamine NONOate; EGF, epidermal growth factor; Ets-1, erythroblastosis virus E26 oncogene homolog 1; L-Arg, L-arginine; NOS2, nitric oxide synthase.
Article Snippet: Cells were transfected with 4 μg pCMV6-XL4 (empty vector) or
Techniques: Activity Assay, Expressing, Western Blot, Phospho-proteomics, Transfection, Control, Plasmid Preparation, Luciferase, Cell Culture, Incubation, Virus
Journal: Breast Cancer Research : BCR
Article Title: Ets-1 is a transcriptional mediator of oncogenic nitric oxide signaling in estrogen receptor-negative breast cancer
doi: 10.1186/bcr3319
Figure Lengend Snippet: NO activation of Ets-1 requires the MEK/ERK signaling pathway . (a) Western blot of relative MEK1/2 (ser 217/221) and ERK1/2 (thr 202/tyr204) phosphorylation in MDA-MB-468 cells transfected with control or NOS2 expression plasmid and cultured with L-Arg or AG. (b) Western blot of relative MEK1/2 (ser 217/221) and ERK1/2 (thr 202/tyr204) phosphorylation in serum-starved cells exposed to EGF or DETANO. (c) Western blot of ERK1/2 (thr 202/tyr204) and Ets-1 (thr 38) phosphorylation in serum-starved MDA-MB-468 cells exposed to EGF (10 ng/ml) or DETANO (0.5 mM), with and without the MEK inhibitor PD 184161. (d) Ets-luciferase activity in serum-starved MDA-MB-468 cells exposed to conditions described in (c). AG, aminoguanidine; DETANO, diethlylenetriamine NONOate; EGF, epidermal growth factor; ERK, extracellular signal-regulated protein kinase; Ets-1, erythroblastosis virus E26 oncogene homolog 1; L-Arg, L-arginine; MEK, mitogen-activated protein kinase; NOS2, nitric oxide synthase.
Article Snippet: Cells were transfected with 4 μg pCMV6-XL4 (empty vector) or
Techniques: Activation Assay, Western Blot, Phospho-proteomics, Transfection, Control, Expressing, Plasmid Preparation, Cell Culture, Luciferase, Activity Assay, Virus
Journal: Breast Cancer Research : BCR
Article Title: Ets-1 is a transcriptional mediator of oncogenic nitric oxide signaling in estrogen receptor-negative breast cancer
doi: 10.1186/bcr3319
Figure Lengend Snippet: Ets-1 activation by NO requires Ras signaling . Western blot of S-nitrosylated, active and total Ras in serum-starved MDA-MB-468 cells (a) transfected with NOS2 expression plasmid and treated with L-Arg or AG and (b) treated with EGF or DETANO. (c) Western blot of Ras-SNO and total Ras from MDA-MB-468 cells exposed to DETANO (0.5 mM) alone or in combination with N-acetyl cysteine (NAC) or sodium azide. (d) Ets-luciferase activity in MDA-MB-468 cells exposed to conditions as above. Significance to DETANO was determined by one-way ANOVA (** P < 0.01). (e) Western blot of Ras and Ets-1 (thr 38) phosphorylation in serum-starved MDA-MB-468 cells exposed to EGF or DETANO (0.5 mM) in the presence or absence of FTS. (f) Western blot of Ets-1 (thr 38) phosphorylation in serum-starved MDA-MB-468 cells exposed to EGF or DETANO (0.5 mM) in the presence or absence of Gö 6976. (g) Ets-luciferase activity in serum-starved MDA-MB-468 cells exposed to EGF or DETANO (0.5 mM) in the presence or absence of FTS or Gö 6976. Significance compared to control was determined by one-way ANOVA (* P < 0.05). (h) Schematic representing the NO-sensitive Ras/MEK/ERK/Ets-1 signaling pathway. AG, aminoguanidine; ANOVA, analysis of variance; DETANO, diethlylenetriamine NONOate; EGF, epidermal growth factor; ERK, extracellular signal-regulated protein kinase; Ets-1, erythroblastosis virus E26 oncogene homolog 1; FTS, farnesylthiosalicylic acid; L-Arg, L-arginine; MEK, mitogen-activated protein kinase; NOS2, nitric oxide synthase.
Article Snippet: Cells were transfected with 4 μg pCMV6-XL4 (empty vector) or
Techniques: Activation Assay, Western Blot, Transfection, Expressing, Plasmid Preparation, Luciferase, Activity Assay, Phospho-proteomics, Control, Virus
Journal: Redox Biology
Article Title: Nitric oxide inhibits FTO demethylase activity to regulate N 6 -methyladenosine mRNA methylation
doi: 10.1016/j.redox.2023.102928
Figure Lengend Snippet: NO inhibits FTO and increases m 6 A-mRNA in cancer cells. a , Relative abundance of m 6 A-mRNA in HCC4006 (lung), MDA-MB-231, -468 (TNBC), OVCAR-4 (ovarian), PC-3 (prostate), and U251 (glioblastoma) cancer cell lines that were treated without (light bars) or with (dark bars) NO (DETA/NO 500 μM, 24 h), ELISA. b , Total m 6 A-mRNA in 2 TNBC cell lines (MDA-MB-231,-468) after 24 h dose course treatment with NO (DETA/NO), ELISA. c , Total m 6 A-mRNA measured after 10 days of NO treatment (DETA/NO 100 μM), ELISA. d , Representative immunoblot for NOS2 protein in MDA-MB-231 ± DETA/NO (500 μM, 24 h), 231VC (transfected with empty vector control), and 231NOS2+ (transfected with NOS2 gene) cells. e , Accumulative NO synthesis (nitrite and nitrate) in the media of MDA-MB-231 (control) cells, 231NOS2+ (NOS2) cells, or 231NOS2+ cells treated with l -NAME (1 mM) after 24 h. f , Relative abundance of m 6 A-mRNA in MDA-MB-231 (control) cells, 231NOS2+ (NOS2) cells, and 231NOS + cells treated with l -NAME (1 mM; 24 h), ELISA. g , Relative abundance of m 6 A-mRNA in MDA-MB-231, and -468 cells after 24 h treatment with NO (500 μM DETA/NO) or the FTO inhibitor meclofenamic acid (MA, 100 μM), ELISA. DETA/NO and MA (IC50 8 μM) both achieve 100 % FTO inhibition at these concentrations. h , Schematic showing how inhibitors of METTL3 (methyltransferase) and FTO affect m 6 A-mRNA levels. i , Representative immunoblot and densitometry for FTO in MDA-MB-231 cells (control), MDA-MD-231 cells transfected with FTO siRNA (FTO knockdown) or transfected with non-targeting siRNA (transfection control) and j , m 6 A-mRNA levels in the same cells treated with or without NO (DETA/NO, 500 μM; 72 h), ELISA. k , m 6 A-mRNA in MDA-MB-231 cells treated NO (DETA/NO 100 μM), or the METTL3 inhibitor cycloleucine (CL, 1 mM), or NO and CL together (n = 4), ELISA. d,i , cell lysates were prepared and immunoblotted with the indicated antibodies, data were independently replicated at least three times, with similar results. a-c , e-g , j n = 3 independent experiments. Data are represented as mean ± s.e.m., P -values were determined by unpaired two-tailed Student's t -tests, median line is shown.
Article Snippet: MDA-MB-231 cells were stably transduced with
Techniques: Enzyme-linked Immunosorbent Assay, Western Blot, Transfection, Plasmid Preparation, Control, Inhibition, Knockdown, Two Tailed Test
Journal: Redox Biology
Article Title: Nitric oxide inhibits FTO demethylase activity to regulate N 6 -methyladenosine mRNA methylation
doi: 10.1016/j.redox.2023.102928
Figure Lengend Snippet: NO and FTO regulate the same m 6 A-mRNA in vitro and in vivo . a , mRNA expression (RT-qPCR) of select m 6 A-methylated transcripts in untreated MDA-MB-231 cells (light blue bars), NO-treated MDA-MB-231 cells (DETA/NO; 500 μM, dark blue bars), and MDA-MB-231 FTO knockdown cells (purple bars) at 72 h. Methylated genes that are upregulated by NO are in the left panel and those that are downregulated by NO are in the right panel, n = 3 separate experiments. b , Relative m 6 A-mRNA levels in MDA-MB-231 xenograft tumors from mice that had “NO-producing” tumors (untreated; dark blue bars), and from mice with tumors that did not synthesize NO, (treated with a NOS2 inhibitor aminoguanidine (AG) for 37 days, light bars), ELISA. c, mRNA expression (RT-qPCR) of genes from the same MDA-MB-231 xenograft tumors ( ± AG) for select genes that were m 6 A-methylated and NO-regulated. Methylated genes that are upregulated by NO are in the left panel and methylated genes that are downregulated by NO are in the right panel. Data are represented as mean ± s.e.m., P- values were determined by unpaired two-tailed Student's t -tests, median line is shown, n = 6 mice/treatment group.
Article Snippet: MDA-MB-231 cells were stably transduced with
Techniques: In Vitro, In Vivo, Expressing, Quantitative RT-PCR, Methylation, Knockdown, Enzyme-linked Immunosorbent Assay, Two Tailed Test
Journal: PLoS ONE
Article Title: Heading towards a dead end: The role of DND1 in germ line differentiation of human iPSCs
doi: 10.1371/journal.pone.0258427
Figure Lengend Snippet: Antibodies used for flow cytometry.
Article Snippet: NANOG ,
Techniques: Cytometry, Conjugation Assay, Recombinant, Control